Section 3. Successful Sequencing
In the next week, because he was too busy with work, Ito never had the chance to see Li Qing again, and he didn’t know whether Li Qing’s confession was successful.
He didn't see Li Qing again until the day he was going to RCNR for experiments.
That morning, as soon as it was light, members of Hill's team gathered in the lobby on the first floor of the"Master Shengong Building" with various large and small instruments and equipment, preparing to go to RCNR. As one of the team's bodyguards, Li Qing stood with Jason and others.
Like other bodyguard soldiers, Li Qing also wore a tight-fitting black military uniform, looking energetic and heroic.
When she saw Ito coming downstairs, she winked and smiled at him. Ito saw Li Qing's hand intertwined with Jason's hand standing next to her, and she immediately understood the meaning of the smile.
Then, Jason walked over to Ito, put his hand on Ito's shoulder, and said gratefully:"Hey, brother, thank you, I know you helped me. To be honest, I was really worried at first, and I kept hesitating. Determined. But Qing showed extraordinary determination and forged ahead, which moved me extremely. Therefore, I also made up my mind to throw away all worries and try my best to love once. No matter what the outcome will be, I think we will all Ready. To be honest, I have to thank you for this."
Ito said absently:"You're welcome." He had mixed feelings in his heart at the moment. He didn't know whether he did the right thing or the wrong thing by encouraging Li Qing to confess, and he didn't know Seeing Li Qing and Jason together, I was at a loss as to whether I was jealous or blessed, sad or happy. However, he quickly put those worries aside for the time being, because he had more important things to do right away.
-
After everyone was ready, they officially set off for RCNR.
Along the way, everyone was on high alert, wary of enemies that might appear at any time and attack them suddenly. Fortunately, the entire journey was uneventful and they arrived at the RCNR without incident.
The person in charge of RCNR warmly received them and led them to the Hadron Collider Laboratory while explaining various precautions to them. Subsequently, after the two parties completed the handover procedures, the person in charge of RCNR left the laboratory and handed over the laboratory to Hill's team for free use.
After Hill's team took over the laboratory, they immediately started working in full swing.
The team members performed their duties as planned and acted efficiently. It took less than an hour to complete all the preparations.
Soon, the experiment entered the implementation stage. Everyone except Raj gathered in the control room of the laboratory.
Jason Hui reported:"The core channel of the laboratory has been closed and isolated from the RCNR's logistics staff. After inspection, it was confirmed that there are no outsiders inside the laboratory."
Engineer Obama Hui reported:"The Casimir negative energy generator, negative energy generator Energy injectors, radiation detectors, controllers and other equipment have all been assembled and connected to the laboratory equipment system. Everything is currently running well."
Hacker Anna Hui reported:"The data calculation optimization software has been installed in the laboratory. In the data processing system, no problems were found through trial operation."
Renahui reported:"Raj has put on the brain-computer interface instrument and is now waiting in a fixed seat at the micro-wormhole generation point."
Sabu reported Lin Hui reported:"The real-time coordinates of Lobo have been calculated and are being tracked and updated in real time. The relevant data has been uploaded to the data processing center."
Then, Professor Fermi said:"Received, start to process Lobo The real-time coordinate data of the star is imported into the theoretical model of wormhole transmission particles for calculation...The import is completed, and the calculation results have been displayed on the big screen."
Then, Ito stared at the amount and method of negative energy injection prompted on the big screen. Get up and running quickly from the console in the control room. Various instruments and equipment in the laboratory began to operate at high speed with Ito's operation.
"The micro wormhole is about to be generated, countdown, ten, nine, eight, seven, six, five, four, three, two, one, the wormhole is open!"Ito shouted loudly.
As soon as Ito finished speaking, the picture on the big screen switched to the camera picture of the micro wormhole generation site. I saw between the two mouths of the giant accelerating tube covered with superconducting magnets, A spherical black"thing" with a diameter of about thirty centimeters and no obvious boundaries appeared. This"thing" was a micro wormhole. A few meters away from the micro wormhole, Raj was made of special materials The seat belt was tied into a sturdy seat fixed on the floor. It could be seen from Raj's expression that he was feeling very uncomfortable due to the strong gravitational pull outside the micro wormhole. The entire micro wormhole site space was affected by The gravitational squeeze caused slight distortion.
Everyone in the control room, except Ito, saw the true appearance of the wormhole for the first time, and they were all amazed. As a physicist, Professor Fermi said that Keep chanting:"Perfect, perfect, perfect……"Sablin was so excited that he shed tears and couldn't help himself. Even Hill, who had always been calm and composed, couldn't help but feel a little moved, looking up at the wormhole with complex eyes.
After Ito waited until the wormhole was stable, he immediately called through the laboratory's broadcaster to Raj, who was sitting next to the wormhole:"Raj, the wormhole has been opened. You can input consciousness energy and"induction" electrons into the wormhole. Hit." After hearing this, Raj quickly resisted the squeeze of gravity, struggled to activate his"divine power", poured the"divine power" into his hands, and then used his hands to output the"divine power" out of the body and shoot it towards the dark insect. In the cave. After the shining"divine power" carrying the"sensing" electrons entered the wormhole, it disappeared without a trace in an instant, as if it had been"swallowed".
Raj immediately closed his eyes, concentrated on it, and entered the"sensing" state.
A few seconds later, Reina looked at the display screen connected to the brain-computer interface instrument and shouted to everyone:"Success! Raj's consciousness energy and"sensing" electrons have traveled to the Lobo planet and are now searching Lobo star."
At the same time, the picture on the big screen also switched to the screen of the brain-computer interface instrument.
A piece of text (Raj's inner monologue) is displayed on the screen:"I sensed another world, which is exactly the same as what I saw before in Lobo. I"saw" a huge luminous creature nearby..My"divine power" is trying to get close to it quickly……"
When everyone saw this text, they knew that Raj's consciousness energy was about to come into contact with the Luobo star people. They all stared at the screen with bated breath, nervously waiting for the next step of information to appear.
After about ten seconds, messages began to pop up one after another on the screen:
"My"divine power" entered the body of the luminous creature...
It did not resist me... but welcomed me very much...
I controlled the"divine power" to enter the organ level...
Its organ structure is very different from our human organ structure......It's strange...
I controlled the"divine power" to enter the cellular level...
Its cell structure is somewhat similar to our human cell structure... But its cells do not have a mitochondrial structure... Instead, there is another coil-like organelle....
This organelle releases huge energy... This energy is very similar to my"divine power"...
I control the"divine power" to enter the DNA level...
Its DNA structure is the same as that of our creatures on earth, and is made of It is composed of deoxyribonucleotides and exists in a double helix structure...
There are a total of 8 pairs of chromosomes in the nucleus...
According to Lena's teachings, in order to facilitate identification, I named these 8 pairs of chromosomes 1 to 8...
Okay , now, I want to use the electromagnetic field formed by the"induction" electrons carried by the"divine power" to identify the characteristic ion current change signal generated by the DNA bases in the chromosome, and sequence the DNA base sequence... Please ask the partners in the control room We record the sequencing results……"
After that, tens of millions of genetic sequencing data began to flash across the big screen at full speed, like a torrential downpour, continuous and dazzling.
Reina looked at those densely packed"ATACGTTATACGTTAGACGTTAGA……"sequence, his eyes were shining with excitement, and he couldn't help shouting:"Very good, very good, babies, I love you to death."
Ito saw that Raj's"sensing" electron had traveled to the Lobo star, capturing When they arrived at Lobo Planet for genetic sequencing, they closed the micro wormhole to prevent the huge gravitational force outside the wormhole from causing continuous damage to Raj's body, so that Raj could maintain good physical condition and continue the genetic sequencing work..
(During the process of closing the micro wormhole this time, the Hawking radiation released by the collapse of the micro black hole was completely shielded by the radiation controller installed at the wormhole generation point, so there was no impact on the micro wormhole like the time in Tokyo. Radiation affects organisms on Earth.)
Subsequently, Raj sequenced the genes of the Lobos for more than two hours before finally completing all the sequencing work. The statistics on the screen showed that the genome of the Lobo star"captured" by Raj contained more than 2 billion base pairs. Raji was able to complete the sequencing in such a short time, which can be considered very efficient.
After Reina saved the data, she shouted through the laboratory radio to Raj, who was still controlling the"divine power":"Raj, the gene sequencing is over, you can stop sensing."
Raj heard the broadcast and controlled" The"divine power" was extracted from Luobo Star's body, and the"divine power" was released in Luobo Star. Then, he took off the brain-computer interface device on his head and slowly opened his eyes.
It could be seen from Raj's eyes that after this round of operations, he became very exhausted. Although using"divine power" to sequence genes does not require as much physical energy as using"divine power" to fight, it is a great test for Raj's spirit.
Upon seeing this, Reina left the control room and came to where Raj was. She squatted next to Raj and asked Raj,"How do you feel? Are you okay?"
Raj shook his head slightly and said,"I My head is very dizzy and uncomfortable."
Reina said:"It's okay, just take a rest. After you recover later, we will capture another Lobo star for genetic sequencing."
Raj said painfully She covered her head and said,"No, I feel really bad."
Reina said,"My dear, hold on a little longer, this is very important to us, understand?"
Raj said with difficulty,"I'm sorry, I really I can't do it, I...I……"As he said this, he couldn't help but vomited, vomiting all over the place, making some of Reina's clothes dirty.
Reina hid aside in disgust and said:"Humph, you useless guy, coward, weakling, I've had enough of you. Forget it, forget it, that's it for today." After saying that, she replied angrily Arrive at the control room.
In the control room, Hill asked Reina:"How is the situation?"
Reina said:"The guy's condition is terrible. He will definitely not be able to do the second genetic sequencing today."
Hill asked :"Does it have to be done a second time?"
Lena said:"Of course. The Lobos are unknown creatures. We know nothing about the full-gene DNA sequence standard materials of these"monsters", so there must be at least two copies. Only by comparing the above individual genome sequencing results with each other can we reasonably analyze their genetic characteristics and draw effective conclusions."
Hill thought for a while and said:"In this case, we can only apply to RCNR for one more large-scale Hadron Collider." He turned to Kevin and said,"Go and communicate with RCNR now."
Kevin nodded and said,"Okay, no problem." Then, he called the person in charge of RCNR. Please call the person in charge of RCNR to apply.
After consultation and discussion with the person in charge of RCNR, Kevin hung up the phone and reported to Hill Hui:"The person in charge of RCNR agreed to our application, but the time he arranged for us to use is one week later, because of the usage this week. The time has been allocated to other scientific research project teams."
Hill said,"Let's do it next week. That's it for today."
Then, everyone began to disassemble various instruments and equipment, packed up their things, and left Hadron Collider Laboratory, set off back to the Master Shengong Building.
Feilu's 18th anniversary brand upgrade gives back to readers! Recharge 100 and get 500 VIP points!
Grab a deposit now (activity time: August 10th to August 20th)
You'll Also Like
-
People in Zongman, double-wearing American comics to extract Superman entries
Chapter 306 110 days ago -
Yue Buqun: I'm already cultivating immortality, why do I still want to be the leader?
Chapter 517 110 days ago -
Elf: My Healing Farm
Chapter 144 110 days ago -
Zongman: Start with Sakurasou and pick up a female high school student
Chapter 354 110 days ago -
Football: Xiao Junguang template, Real Madrid begs me to let him go
Chapter 156 110 days ago -
Taking stock of the American comic universe, the black robe universe shocked the superheroes
Chapter 154 110 days ago -
Collapse: Beginning Production Game
Chapter 414 110 days ago -
Knight: Infinite Summoning, Support the Goddess of Creation
Chapter 330 110 days ago -
Universal copy: invincible from negative ninety-nine level
Chapter 152 110 days ago -
Original God: My previous life is revealed, I am the Archbishop of Destiny
Chapter 128 110 days ago